cdna cdna Search Results


96
New England Biolabs protoscript first strand cdna synthesis kit
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Protoscript First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protoscript first strand cdna synthesis kit/product/New England Biolabs
Average 96 stars, based on 1 article reviews
protoscript first strand cdna synthesis kit - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
PCR Biosystems Ltd qpcrbio cdna synthesis kit
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Qpcrbio Cdna Synthesis Kit, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qpcrbio cdna synthesis kit/product/PCR Biosystems Ltd
Average 96 stars, based on 1 article reviews
qpcrbio cdna synthesis kit - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

98
New England Biolabs protoscript ii kit
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Protoscript Ii Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protoscript ii kit/product/New England Biolabs
Average 98 stars, based on 1 article reviews
protoscript ii kit - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

93
Solis BioDyne rt cdna synthesis kit
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Rt Cdna Synthesis Kit, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt cdna synthesis kit/product/Solis BioDyne
Average 93 stars, based on 1 article reviews
rt cdna synthesis kit - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

95
Solis BioDyne rt cdna synthesis mix
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Rt Cdna Synthesis Mix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt cdna synthesis mix/product/Solis BioDyne
Average 95 stars, based on 1 article reviews
rt cdna synthesis mix - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

92
R&D Systems celec5a rdc2597 cdna orf constructs
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Celec5a Rdc2597 Cdna Orf Constructs, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/celec5a rdc2597 cdna orf constructs/product/R&D Systems
Average 92 stars, based on 1 article reviews
celec5a rdc2597 cdna orf constructs - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

90
R&D Systems gpr4
a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV <t>cDNA</t> for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.
Gpr4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gpr4/product/R&D Systems
Average 90 stars, based on 1 article reviews
gpr4 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

92
R&D Systems human abca1 np 005493 versaclone cdna plasmid
<t>ABCA1</t> expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.
Human Abca1 Np 005493 Versaclone Cdna Plasmid, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human abca1 np 005493 versaclone cdna plasmid/product/R&D Systems
Average 92 stars, based on 1 article reviews
human abca1 np 005493 versaclone cdna plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
R&D Systems cd8a hispid cotton rat sigmodon hispidus sequences
Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, <t>Sigmodon</t> <t>hispidus</t> - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Cd8a Hispid Cotton Rat Sigmodon Hispidus Sequences, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cd8a hispid cotton rat sigmodon hispidus sequences/product/R&D Systems
Average 93 stars, based on 1 article reviews
cd8a hispid cotton rat sigmodon hispidus sequences - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
R&D Systems plasmid hcd47 versaclone cdna
Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, <t>Sigmodon</t> <t>hispidus</t> - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Plasmid Hcd47 Versaclone Cdna, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid hcd47 versaclone cdna/product/R&D Systems
Average 93 stars, based on 1 article reviews
plasmid hcd47 versaclone cdna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
R&D Systems human pdgf bb
Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, <t>Sigmodon</t> <t>hispidus</t> - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Human Pdgf Bb, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human pdgf bb/product/R&D Systems
Average 94 stars, based on 1 article reviews
human pdgf bb - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
R&D Systems human pdgf ab
Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, <t>Sigmodon</t> <t>hispidus</t> - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Human Pdgf Ab, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human pdgf ab/product/R&D Systems
Average 93 stars, based on 1 article reviews
human pdgf ab - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV cDNA for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.

Journal: Nature Immunology

Article Title: Antigen specificity of clonally enriched CD8 + T cells in multiple sclerosis

doi: 10.1038/s41590-025-02412-3

Figure Lengend Snippet: a , Summary of EBV DNA ddPCR results from CSF supernatant in which EBER2 was normalized to a housekeeping gene (MS/CIS, n = 13; HC/OND, n = 5). b , EBV cDNA for each of the indicated genes were measured by ddPCR and normalized to a housekeeping gene. Each sample was run in duplicate and each dot represents the average result from each study participant. Data are the mean ± s.e.m. MS/CIS and HC/OND samples were compared using an unpaired two-tailed Student’s t -test with Welch’s correction; NS, not significant; n = 13 for MS/CIS for all genes except EBER2 where n = 12 due to lack of sufficient sample for MS27 and n = 5 in HC/OND for all genes except BamHI-W where n = 4 due to a lack of sufficient sample for OND4.

Article Snippet: Complementary DNA was synthesized using a ProtoScript first strand cDNA synthesis kit (NEB) using 6 μl RNA per 20 μl reaction volume according to the manufacturer’s instructions.

Techniques: Two Tailed Test

ABCA1 expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Migration, Gene Expression, Standard Deviation, Western Blot, Over Expression, Transwell Migration Assay, Membrane

ABCA1 expression is differentially regulated in mesenchymal cell lines through the E-box motif in its proximal promoter. ( a ) This schematic outlines the structure of ABCA1 alternative promoters. ( b ) Luminescence induced by alternative proximal promoters P1 or P2 are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) Luminescence induced by promoter P1, or promoter fragments P1a and P1b, are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. ( d ) This shows the mutations introduced to the P1b promoter fragment to disrupt binding capacity of the E-box, SP1, and LXR motifs. Mutations are labeled in bold. ( e ) Luminescence is shown on the x -axis for each of the mutant promoters in the MCF7, HMLE, MDA-MB-231, and HMLE-Twist cell lines ( n = 4 technical replicates, for each). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is differentially regulated in mesenchymal cell lines through the E-box motif in its proximal promoter. ( a ) This schematic outlines the structure of ABCA1 alternative promoters. ( b ) Luminescence induced by alternative proximal promoters P1 or P2 are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) Luminescence induced by promoter P1, or promoter fragments P1a and P1b, are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. ( d ) This shows the mutations introduced to the P1b promoter fragment to disrupt binding capacity of the E-box, SP1, and LXR motifs. Mutations are labeled in bold. ( e ) Luminescence is shown on the x -axis for each of the mutant promoters in the MCF7, HMLE, MDA-MB-231, and HMLE-Twist cell lines ( n = 4 technical replicates, for each). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Standard Deviation, Binding Assay, Labeling, Mutagenesis

MYC binds to the ABCA1 promoter and represses its expression in epithelial cells. ( a ) This volcano plot shows the relative log 2 expression of E-box binding transcription factors on the x -axis. Each transcription factor is shown as a dot, and those expressed higher in mesenchymal cells are shown on the right, while those expressed higher in epithelial cells are on the left. The y -axis shows the −log 10 of the p -value. A dotted line indicates p = 0.05. ( b ) The gene ( top ) and protein ( bottom ) expressions of ABCA1 are shown for four cell lines ( n = 3 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) The relative gene expressions of ABCA1 , MYC , or CDH1 are shown on the y -axis across time ( x -axis) in log scale ( n = 3 technical replicates). Error bars indicate one standard deviation. ( d ) ( top panel ) The relative gene expressions of ABCA1 or MYC in HMLE cells are shown on the y -axis after knockdown with three independent siRNAs targeting MYC ( n = 3 technical replicates). Error bars indicate one standard deviation. ( bottom ) These immunoblots show the protein expression in the same conditions. ( e ) The binding affinity of MYC to the ABCA1 promoter or a gene desert ( GD ) region is quantified relative to input ( y -axis) ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for experiments shown in panels b, d, and e, and representative data are shown. The data in panel ( a ) were aggregated from six data sets. For panel ( c ), the time series has been measured over five times, but the time points profiled in the middle samples varied. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: MYC binds to the ABCA1 promoter and represses its expression in epithelial cells. ( a ) This volcano plot shows the relative log 2 expression of E-box binding transcription factors on the x -axis. Each transcription factor is shown as a dot, and those expressed higher in mesenchymal cells are shown on the right, while those expressed higher in epithelial cells are on the left. The y -axis shows the −log 10 of the p -value. A dotted line indicates p = 0.05. ( b ) The gene ( top ) and protein ( bottom ) expressions of ABCA1 are shown for four cell lines ( n = 3 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) The relative gene expressions of ABCA1 , MYC , or CDH1 are shown on the y -axis across time ( x -axis) in log scale ( n = 3 technical replicates). Error bars indicate one standard deviation. ( d ) ( top panel ) The relative gene expressions of ABCA1 or MYC in HMLE cells are shown on the y -axis after knockdown with three independent siRNAs targeting MYC ( n = 3 technical replicates). Error bars indicate one standard deviation. ( bottom ) These immunoblots show the protein expression in the same conditions. ( e ) The binding affinity of MYC to the ABCA1 promoter or a gene desert ( GD ) region is quantified relative to input ( y -axis) ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for experiments shown in panels b, d, and e, and representative data are shown. The data in panel ( a ) were aggregated from six data sets. For panel ( c ), the time series has been measured over five times, but the time points profiled in the middle samples varied. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Binding Assay, Standard Deviation, Knockdown, Western Blot

Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, Sigmodon hispidus - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Journal: Journal of immunological methods

Article Title: Cross-reactivity of T cell-specific antibodies in the bank vole (Myodes glareolus).

doi: 10.1016/j.jim.2023.113524

Figure Lengend Snippet: Fig. 2. A) Tree showing phylogenetic relationships among rodent species discussed in the article. Tree topology was based on a rodent phylogenetic tree published by Steppan and Schenk (2017), with root scaled to the median divergence time between Myodes and Mus reported on Timetree (see the main text). B) Pairwise amino acid sequence identity (upper-diagonal, in blue) and similarity (lower diagonal, in grey) matrices for CD4, CD8α and CD8β molecules. Mus musculus – mouse, Rattus norvegicus – rat, Peromyscus maniculatus - eastern deer mouse, Sigmodon hispidus - hispid cotton rat, Cricetulus griseus - Chinese hamster, Mesocricetus auratus - Syrian hamster, Microtus ochrogaster - prairie vole, Myodes glareolus – bank vole, and Homo sapiens, human. For brevity, only the generic name is provided on the figure. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: In addition, because anti-CD4 and anti-CD8α cotton rat-specific mAbs are commercially available, CD4 and CD8A hispid cotton rat (Sigmodon hispidus) sequences were obtained from commercially available constructs (Cotton Rat CD4 VersaClone cDNA, cat# RDC1063, R&D Systems; Cotton Rat CD8 alpha (AAL55392) VersaClone cDNA, cat# RDC0871, R&D Systems), which had been used A M. Migalska et al. Journal of Immunological Methods 520 (2023) 113524 in the construction of said antibodies.

Techniques: Sequencing

Fig. 3. Expression of the CD4, CD8α and LCK genes in three sorted populations of cells: “CD4+” - CD3 + CD4+; “CD8+” - CD3 + CD4-; “neg” - CD3-CD4-. Relative normalized expression levels were measured with ΔΔCt method, with calibrator sample (“Calib”) prepared by mixing RNA from the three cell populations. TBP (TATA box binding protein) was used as a reference gene.

Journal: Journal of immunological methods

Article Title: Cross-reactivity of T cell-specific antibodies in the bank vole (Myodes glareolus).

doi: 10.1016/j.jim.2023.113524

Figure Lengend Snippet: Fig. 3. Expression of the CD4, CD8α and LCK genes in three sorted populations of cells: “CD4+” - CD3 + CD4+; “CD8+” - CD3 + CD4-; “neg” - CD3-CD4-. Relative normalized expression levels were measured with ΔΔCt method, with calibrator sample (“Calib”) prepared by mixing RNA from the three cell populations. TBP (TATA box binding protein) was used as a reference gene.

Article Snippet: In addition, because anti-CD4 and anti-CD8α cotton rat-specific mAbs are commercially available, CD4 and CD8A hispid cotton rat (Sigmodon hispidus) sequences were obtained from commercially available constructs (Cotton Rat CD4 VersaClone cDNA, cat# RDC1063, R&D Systems; Cotton Rat CD8 alpha (AAL55392) VersaClone cDNA, cat# RDC0871, R&D Systems), which had been used A M. Migalska et al. Journal of Immunological Methods 520 (2023) 113524 in the construction of said antibodies.

Techniques: Expressing, Binding Assay